The Anonymous Game

vihcgicgicugcugcgucfucufcugcugcugcgucguccgucgucgicjgcgicgicgucigcgicgu

History of humankind

英年早婚的她

反复被同一个男人拒绝（抛弃？）的她竟然要英年早婚了？ 结婚对象是何人？ 结婚原因怎么这么不可描述呐

His Dear Devilish Angel

------------------ After witnessing the cruel reality of the world at a very young age, she matured early. However, despite giving her everything, she couldn't save her family from myriads of schemes. she got used to the darkness so much to the point of subconsciously running away from light. Having been forced to wear his name since her 18th birthday, she was angered at the mere thought of him. yet knowing that it was his territory, she willingly walked in. ------------------- "I remember telling you my little fox, if you came back, your escape chances will be zero to none." he said as he gently outlined her jawline down to her neck and her clavicle with his jade like fingers. "Oh, and what makes you think you can control my life?" her eyes had the very same indifference she carried when she entered the room. seeing those eyes, his lips curved in amusement, he took hold of her right wrist and showed her the bracelet she was wearing. "Well, you already have my stamp on you, so... from your mind to your heart and from your body to soul, everything is under my ownership,.... all of you are mine, baby girl." her indifferent eyes instantly filled with anger and irritation. She glared at him and forcefully pulled her hand out of his grip. he chuckled dotingly at her reaction as he held her face in his palms and said, " Now that's my little fox with those bright eyes." -------------------

ends from where it all starts

vasheee

Messed Up Middle

Love sad stroys and dispare. Come no further sadly you've come to the right book.

Igcyoffihcihcigcyick khcyffjg

The novel is not available.

the bloody game

CANBION AND EVIL EYE

I'm just Healer so What?

Please Don't Unrequited Love

Sesilia Goenawan (25), mulai mundur perlahan dari hubungan tanpa status yang dia jalani bersama pria plin-plan yang membelenggunya dalm posisi orang ketiga. Di tengah ketidakpastian itu, Sesil memilih melepaskan diri dengan berbagai cara hingga mengundurkan diri dari tempat bekerjanya. Walaupun Sesil tidak terlahir dalam keluarga kaya raya, dia adalah anak kedua dari Goenawan Biantoro, seorang psikolog klinis yang dihormati. Suatu hari, papanya menawarkan sebuah pekerjaan bagus di perusahaan milik salah satu klien regularnya, Hartanto Wibisono, mantan CEO Early Morning Group yang baru dua tahun ini pensiun. Perusahaan yang berbasis di bidang perhotelan dan konstruksi itu kini dipimpin anak sematawayangnya, Aldwinanta Anggara (27). Muda dan tampan. Namun sayang, sikapnya yang dingin, perfeksionis dan intoleran itu telah membuat satu-persatu pegawainya mengundurkan diri hanya karena kesalahan kecil–termasuk orang kepercayaan ayahnya yang telah bekerja selama puluhan tahun. Awalnya Sesil menolak tawaran itu karena merasa tidak cocok dengan jabatan pekerjaan itu. Namun, permintaan papanya akan sesuatu, Sesil pun bersedia. Minggu pertama bekerja, Sesil terkejut bukan main saat mengetahui bahwa bosnya adalah senior kejam yang pernah menolak cintanya mentah-mentah semasa SMA. Sementara Al sendiri nyaris saja tidak menyadari siapa gadis berparas cantik bak model terkenal yang kini menjadi sekretarisnya itu. Kemudian satu hal yang Aldwinanta tak ketahui, rahasia kelam dan titik kelemahannya kini ada dalam genggaman Sesil. Lantas apakah yang akan Sesil lakukan? Mampukah dia bersikap biasa saja? Atau malah membuat permainan balas dendam?

Waktu untuk sebuah Cerita.

trdt

Sent Back From Hell To Teach Evil

after being an adventurer Xeno settled down with one of his party members. She always got her way. After Xeno found out their child wasn't his he finally drew the line and never left his weapon shop. after a year of no support Lyn comes to his shop with a threat to ruin Xeno's name. Afterwards Xeno continues to work on a sword to help the war efforts. later that night he is assassinated in the after life he is given a second chance.

How not to be Multiverse Mercenary

In his previous life, Leo was confined to a bed with a terminally ill body, brimming with talent but completely immobilized. Tragically, he couldn't even fulfill his passion for firearms. After enduring a life filled with suffering, he was reincarnated into a new existence. Driven by an intense lust for guns and marked by immaturity, he carelessly navigated his new life, which led to disastrous consequences: he lost his left arm and an eye. Just when it seemed his fortunes could not worsen, an opportunity emerged in the form of a cliché system. This system presented Leo with a critical mission: he was required to travel across various anime and movie worlds to eliminate other Isekai protagonists. His task was to correct the anomalies disrupting these worlds to prevent cataclysmic interference from outer gods. This mission not only gave Leo a chance to engage his gun fascination but also provided a pathway to potentially redeem his tumultuous past. Main world: Black Lagoon Nisekoi Jormungand Traveling worlds: One Punch Man Fairy Tail === English isnt my main language and if you are looking for Gary Stu type of MC then it is not for you. It is comedy, harem and action. Harem being undecided for the time being.

Somehow Deep Inside Us

Will two person be together despite the fact that they are at the different part of the world? Will this two conquer the distance? "Will you marry me? Zoori asked "Are you out of your mind? Summer answer to his questions asked by the man talking to her phone. Summer reply with no hesitation "yes" out of revenge to the man she love for years, to show him that even without him there are a lot more who can still love her..

DARK

I don’t have any motivation to continue this sorry

Deleted sorry

Since ma buht garden ho please mere madee kar ma apnanumbersow ni kar

The blood lorde

As the trash of the and exile of the vampires,I live with humans since I couldn't even awaken the vampires bloodline. But I encountered a twist of fate,those who exiled me will pay

deleted bok

Shift to new one

Steaua dimineții

Shadows of Ambition: A Mafia Odyssey

Ice & Cream

Persahabatan dua anak manusia yang berbeda karakter 180 derajat, namun pada akhirnya terjerat dalam perasaan cinta yang terlalu dalam disaat salah satunya telah memiliki tambatan hati. Bagaimana mereka mengatasinya?

super hero sekolah

Hariz seorang murid yang mempunyai kuasa yang luar biasa. Suatu hari sekolah Hariz diceroboh oleh raksaksa gunung ledang. Hariz cuba melawan tetapi tidak mampu melawan raksaksa itu seorang diri. Apakah yang akan terjadi kepada hariz ? Mampukah hariz untuk melawan raksaksa itu? Siapakah yang akan menolong hariz melawan raksaksa?

The Dragon King's Capture

A dragon king. A virgin sacrifice. Two hearts are forced together, but can they find love in the struggle? We stand in silence for what feels like an eternity, his arms boxing me in, preventing me from leaving. Finally, I feel his chin connect with the top of my head, bumping it slightly before resting gently. He’s so close, I can smell his scent—like burnt wood and wildflowers. When he speaks again, his voice buzzes through my entire body. “I believe I need you,” he says, his voice hardly more than a breath. My face explodes with heat. His hands grab the sides of my head, tilting it up. I feel his breath against my lips, heavy and warm. My own breath catches in my throat, and I feel my nerves shaking under my skin. The Dragon King's Capture is created by Tori Lear, an eGlobal Creative Publishing signed author.

The GATE Academy

The Gifted And Talented Education Academy. In a fantastical world where legend and reality coexist, the GATE Academy shines as a beacon of inspiration. Located on the pacific island of Arcadia, the Academy serves as a safe haven for the "talented," or those of supernatural ability. Follow the story of Shizuo Akiro, a 16-year old protege, as he enters his junior year at the GATE Academy. Since a young age, he's known that life wasn't always going to go as planned, so when new and old powers arise to challenge society as it were, setting aside some time in the classroom wasn't going to be a problem. A fight fought alone would be unwise, but thankfully Shizuo's years at GATE has blessed him with faithful companions. With a powerful group of ragtag teens, Shizuo leads the charge against the greatest evil of their time. The journey ahead will be a struggle, an epic adventure with all lives on the line, but that does not scare Shizuo Akiro. In fact, it just makes it all the more worth the ride.

Artifacts creater

The Blood Moon by Moonlight

A BLIND LOVE

People say love is blind, some don't believe it but it might be true. This is a love story between a blind rich girl and an orphan. They are both completely different from each other. She has loved ones but he has no one. She lives a hard yet simple life but he has been struggling all his life. Join me as i tell you more about the halal love life of Ava and Ali. I'm dedicating this story to blind people. Just because they are blind doesn't mean they have to be loved less. They are humans just like us and they deserve to be loved and treated with respect.

Insanity: Joshua's Hell

Mighty Cocoon

[ This is a gene evolution genre novel. Will update the synopsis as I work on the novel. I will also be fine tuning the already released chapters at the early stages. Your feedback is welcome. ]

Harem - Merchant Ranker

----- Konten Dewasa 18+ ----- Nama saya Reiju. Sebagai seorang anak, Aku terlibat dalam kepanikan zombie di tempat penampungan di Jepang di Bumi, dan pada hari Aku meninggal, aku bereinkarnasi ke dunia pedang dan sihir yang berbeda sambil mengenakan pakaian Bumi. 　 Mengapa di dunia yang berbeda? Bagaimana dengan orang lain di tempat penampungan? Bisakah Aku kembali? Aku tidak dapat menemukan jawaban atas pertanyaan itu, dan sudah lima tahun sejak Aku belajar bagaimana hidup di dunia ini. Aku sekarang dalam profesi yang disebut Charis, peringkat dalam format peringkat yang disebut ranker pedagang atau Merchant Ranker.

Albus Potter and the twin princess of Fire and Ice

do you think everything will be oh ok with the twin sister's and will Albus potter help them understand what is important or will he fall in love one of them the answer is with them

dsfsdljfds

df;adklflad

Battle of the Fallen

This is a Battle between the Fallen. Shi never believed in Demons or evil creatures, he's a 16 year old boy who stopped from school to work for his little sister. Due to his misfortunate, he always ended unemployed at the end of the day. One day, out of nowhere, a demon appeared in front of him but before it could eat his soul.. a girl helped him and that's how he met Toya, the girl who appeared to be part of an underground organization who hunt down Demons who eats mortal's soul. Because of the high salary that they'd get after killing a demon, Shi decided to join them and that's where the real battle begin. (Cttro of the picture)

2hfjcjf

Love Jack